Tools‎ > ‎Sequence data‎ > ‎

Multi-FASTA format

FASTA format

FASTA is a text-file format for representing nucleotide sequences or peptide (amino acids) sequences.
A FASTA file begins with a description line which starts with ">" and includes the sequence identifier and a description. The following lines contain the sequence data.

Multi-FASTA format

A multi-FASTA file contains multiple FASTA formated sequences.

Example:

>sequenceID-001 description
AAGTAGGAATAATATCTTATCATTATAGATAAAAACCTTCTGAATTTGCTTAGTGTGTAT
ACGACTAGACATATATCAGCTCGCCGATTATTTGGATTATTCCCTG

>sequenceID-002 description
CAGTAAAGAGTGGATGTAAGAACCGTCCGATCTACCAGATGTGATAGAGGTTGCCAGTAC
AAAAATTGCATAATAATTGATTAATCCTTTAATATTGTTTAGAATATATCCGTCAGATAA
TCCTAAAAATAACGATATGATGGCGGAAATCGTC
>sequenceID-003 description
CTTCAATTACCCTGCTGACGCGAGATACCTTATGCATCGAAGGTAAAGCGATGAATTTAT
CCAAGGTTTTAATTTG



See also
 Wikipedia